NSAA 2021 Biology PART D
17 questions17 marksUpdated October 2025
The NSAA 2021 Biology PART D paper in full: all 17 questions, each with its answer. NSAA is the Natural Sciences Admissions Assessment. Sit it cold under exam timing, mark it, then work back through anything you missed using the solutions below.
Download the original PDF →Questions and answers are free. Full step-by-step worked solutions unlock with a free account. Start practising.
Question 61
1 markA selection pressure is a biological or physical factor in an environment that may result in evolution.
Which of the following situations result in selection pressures on one or more organisms?
1 clearing rainforests to grow palm oil plantations
2 introduction of a predator to islands with seabird colonies
3 long-term use of antibiotics in hospital wards
4 using an insecticide to kill the mosquitoes that spread malaria
Which of the following situations result in selection pressures on one or more organisms?
1 clearing rainforests to grow palm oil plantations
2 introduction of a predator to islands with seabird colonies
3 long-term use of antibiotics in hospital wards
4 using an insecticide to kill the mosquitoes that spread malaria
- A.1 and 2 only
- B.1 and 4 only
- C.2 and 3 only
- D.1, 2 and 3 only
- E.2, 3 and 4 only
- F.1, 2, 3 and 4
Answer: F
Question 62
1 markA particular cell has the following features:
• a cell wall
• a cell membrane
• no mitochondria
Which of the following statements about this cell is correct?
• a cell wall
• a cell membrane
• no mitochondria
Which of the following statements about this cell is correct?
- A.It may be an animal cell.
- B.It may have no nucleus.
- C.It may contain chloroplasts.
- D.It contains X and Y chromosomes.
- E.It is not able to respire.
Answer: B
Question 63
1 markA cell is studied. The graph shows the concentration of a substance at different distances from the cell membrane. The concentrations shown are maintained over time.

Which of the following processes is/are responsible for maintaining the difference in the concentration of the substance across the membrane?
1 active transport
2 diffusion
3 osmosis

Which of the following processes is/are responsible for maintaining the difference in the concentration of the substance across the membrane?
1 active transport
2 diffusion
3 osmosis
- A.none of them
- B.1 only
- C.2 only
- D.3 only
- E.1 and 2 only
- F.1 and 3 only
- G.2 and 3 only
- H.1, 2 and 3 only
Answer: B
Question 64
1 markThe diagram shows some of the ways in which glucose can be added to or removed from blood plasma in humans.

Which hormones stimulate the processes shown by the arrows?


Which hormones stimulate the processes shown by the arrows?

- A.process 1: adrenaline, process 2: glucagon, process 3: insulin
- B.process 1: adrenaline, process 2: adrenaline glucagon, process 3: glucagon
- C.process 1: insulin, process 2: adrenaline, process 3: glucagon
- D.process 1: insulin, process 2: insulin, process 3: adrenaline glucagon
- E.process 1: glucagon, process 2: insulin, process 3: glucagon
- F.process 1: glucagon, process 2: glucagon, process 3: insulin
Answer: D
Question 65
1 markThe diagram shows two gametes, gamete P and gamete Q, fusing to form cell R in a healthy human. R divides to form two cells, S and T.
S and T grow into two separate individuals.

Which of the following statements is/are correct?
1 The number of double strands of DNA is the same in gamete P and cell T.
2 If gamete Q contains a Y chromosome, then both individuals that grow from cells S and T will be genetically male.
3 A mutation in the DNA in cell R before mitosis will always change the phenotype of cell S.
S and T grow into two separate individuals.

Which of the following statements is/are correct?
1 The number of double strands of DNA is the same in gamete P and cell T.
2 If gamete Q contains a Y chromosome, then both individuals that grow from cells S and T will be genetically male.
3 A mutation in the DNA in cell R before mitosis will always change the phenotype of cell S.
- A.none of them
- B.1 only
- C.2 only
- D.3 only
- E.1 and 2 only
- F.1 and 3 only
- G.2 and 3 only
- H.1, 2 and 3
Answer: C
Question 66
1 markThe graph shows changes in population size (number of individuals) of a species of tortoise over the last century. These tortoises are only found on one small island in the Galapagos.

Which of the following could account for the change in population shown after time Z on the graph?
1 reduced rainfall
2 reduced availability of resources
3 failure to adapt to competition from an introduced species

Which of the following could account for the change in population shown after time Z on the graph?
1 reduced rainfall
2 reduced availability of resources
3 failure to adapt to competition from an introduced species
- A.none of them
- B.1 only
- C.2 only
- D.3 only
- E.1 and 2 only
- F.1 and 3 only
- G.2 and 3 only
- H.1, 2 and 3
Answer: H
Question 67
1 markAn enzyme-catalysed reaction was studied and the mass of product formed was measured over time.
The results are shown in the graph.

Which of the following statements is/are correct?
1 The enzymes may have been used up in the reaction.
2 The initial rate of reaction is .
3 At high concentrations, the product formed may inhibit the enzymes.
The results are shown in the graph.

Which of the following statements is/are correct?
1 The enzymes may have been used up in the reaction.
2 The initial rate of reaction is .
3 At high concentrations, the product formed may inhibit the enzymes.
- A.none of them
- B.1 only
- C.2 only
- D.3 only
- E.1 and 2 only
- F.1 and 3 only
- G.2 and 3 only
- H.1, 2 and 3
Answer: D
Question 68
1 markA person ran on a treadmill for 360 seconds. Their rates of aerobic and anaerobic respiration were measured at the start and at the end of the time. The table shows the results.

Physiological changes occurred in the person during this time.
Which of the following statements is/are correct during the 360 seconds?
1 There was an increase in pH that caused a change in the shape of the respiratory enzyme's active sites.
2 Part of the increase in the rate of cellular respiration may have been due to a temperature increase in the muscles.
3 More carbon dioxide needed to be removed from the muscle cells.

Physiological changes occurred in the person during this time.
Which of the following statements is/are correct during the 360 seconds?
1 There was an increase in pH that caused a change in the shape of the respiratory enzyme's active sites.
2 Part of the increase in the rate of cellular respiration may have been due to a temperature increase in the muscles.
3 More carbon dioxide needed to be removed from the muscle cells.
- A.none of them
- B.1 only
- C.2 only
- D.3 only
- E.1 and 2 only
- F.1 and 3 only
- G.2 and 3 only
- H.1, 2 and 3
Answer: G
Question 69
1 markCoat colour variation in a particular population of mice is only affected by one gene with two alleles, R and r. This gene is not on a sex chromosome.
Heterozygous mice have yellow fur. Embryos that are homozygous dominant do not survive.
A yellow male and a yellow female mouse were mated several times and a large number of offspring were produced. Some of the offspring were grey in colour and others were yellow.
Assuming that no new mutations have occurred, which of the following is correct?
Heterozygous mice have yellow fur. Embryos that are homozygous dominant do not survive.
A yellow male and a yellow female mouse were mated several times and a large number of offspring were produced. Some of the offspring were grey in colour and others were yellow.
Assuming that no new mutations have occurred, which of the following is correct?
- A.25% of the live offspring will be grey in colour.
- B.All grey mice have a homozygous genotype for coat colour.
- C.Offspring with XY chromosomes are all heterozygous for coat colour.
- D.The live offspring of a cross between a yellow and a grey mouse will always be yellow.
- E.There is a 3:1 ratio of dominant to recessive alleles for this gene in the live offspring.
Answer: B
Question 70
1 markOne strand of a section of DNA has the following sequence of bases:
AATCGGTCTTGCGGCCAAGGCCCTT
The complementary strand is not shown.
The charts show the proportions of the four bases A, C, G and T.
Which chart shows the correct proportions of bases for this section of double-stranded DNA?
(Assume no mutations.)

AATCGGTCTTGCGGCCAAGGCCCTT
The complementary strand is not shown.
The charts show the proportions of the four bases A, C, G and T.
Which chart shows the correct proportions of bases for this section of double-stranded DNA?
(Assume no mutations.)

- A.A pie chart with four unequal sectors labelled A, C, G, T.
- B.A pie chart with four unequal sectors labelled A, C, G, T.
- C.A pie chart with four unequal sectors labelled A, C, G, T.
- D.A pie chart with four unequal sectors labelled A, C, G, T.
- E.A pie chart with four sectors. Sectors for A and T are equal. Sectors for C and G are equal. A/T sectors are larger than C/G sectors.
- F.A pie chart with four unequal sectors labelled A, C, G, T.
Answer: A
Question 71
1 markTwo identical plant cells were removed from a leaf. One was placed in a concentrated sugar solution and the other was placed in distilled water, and both were left for 2 hours.
All other factors were kept constant during the experiment. The diagram shows the results, with regions of each cell labelled Q and S.


Which of the following statements is/are correct?
1 In the cell in distilled water, Q contains only distilled water.
2 In the cell in concentrated sugar solution, the number of solute particles in Q increased over the two hours.
3 S is a vacuum.
All other factors were kept constant during the experiment. The diagram shows the results, with regions of each cell labelled Q and S.


Which of the following statements is/are correct?
1 In the cell in distilled water, Q contains only distilled water.
2 In the cell in concentrated sugar solution, the number of solute particles in Q increased over the two hours.
3 S is a vacuum.
- A.none of them
- B.1 only
- C.2 only
- D.3 only
- E.1 and 2 only
- F.1 and 3 only
- G.2 and 3 only
- H.1, 2 and 3
Answer: A
Question 72
1 markThe diagram shows some chemical processes involved in the carbon cycle. Three of these multi-stage processes are labelled P, Q and R.

Which of the following statements is/are correct?
1 P requires the presence of mitochondria.
2 Overall, Q releases heat.
3 R is sensitive to changes in pH and temperature.

Which of the following statements is/are correct?
1 P requires the presence of mitochondria.
2 Overall, Q releases heat.
3 R is sensitive to changes in pH and temperature.
- A.none of them
- B.1 only
- C.2 only
- D.3 only
- E.1 and 2 only
- F.1 and 3 only
- G.2 and 3 only
- H.1, 2 and 3
Answer: D
Question 73
1 markTwo different cells, cell L and cell M, were studied using a microscope and then drawn. The drawings are not shown.
Some of the data collected is shown in the table.

Which of the following statements is/are correct?
1 Cell L has been magnified 50 times.
2 Cell M has been magnified 5 times as much as cell L.
3 Both cells could have a cell wall.
Some of the data collected is shown in the table.

Which of the following statements is/are correct?
1 Cell L has been magnified 50 times.
2 Cell M has been magnified 5 times as much as cell L.
3 Both cells could have a cell wall.
- A.none of them
- B.1 only
- C.2 only
- D.3 only
- E.1 and 2 only
- F.1 and 3 only
- G.2 and 3 only
- H.1, 2 and 3
Answer: H
Question 74
1 markThe pedigree diagram shows the inheritance of a phenotypic feature caused by a recessive allele.

What is the probability that individual 6 is an unaffected male?

What is the probability that individual 6 is an unaffected male?
- A.12.5%
- B.25%
- C.37.5%
- D.50%
- E.62.5%
- F.75%
Answer: C
Question 75
1 markThe diagrams show the daughter cells produced when three different stem cells divide.


Which of the following statements is correct?


Which of the following statements is correct?
- A.Only stem cell 1 shows division by mitosis.
- B.Some cancers result from divisions like that shown for stem cell 1.
- C.The total number of stem cells increases if they divide like stem cell 2.
- D.Stem cells in adults divide like stem cell 3.
- E.The total number of stem cells is maintained if they divide like stem cell 3.
Answer: B
Question 76
1 markA fungus feeds by releasing amylase onto starchy food. The soluble products of the breakdown of starch are absorbed by the fungus.
Test tubes were set up containing a mixture of starch solution and fungus. Each test tube was maintained at a different temperature between 5°C and 45°C.
Samples of the mixture were removed early in the experiments to determine the initial rates of this enzyme-catalysed reaction.
The results were plotted.
All of the other variables were kept constant.
Which graph shows the expected results?

Test tubes were set up containing a mixture of starch solution and fungus. Each test tube was maintained at a different temperature between 5°C and 45°C.
Samples of the mixture were removed early in the experiments to determine the initial rates of this enzyme-catalysed reaction.
The results were plotted.
All of the other variables were kept constant.
Which graph shows the expected results?

- A.Graph showing rate of reaction decreasing as temperature increases from 5 to 45°C.
- B.Graph showing rate of reaction high at 5°C, decreasing to a minimum, then increasing to 45°C (U-shaped).
- C.Graph showing rate of reaction decreasing linearly as temperature increases from 5 to 45°C.
- D.Graph showing rate of reaction increasing as temperature increases from 5 to 45°C, with the rate of increase slowing down towards 45°C.
- E.Graph showing rate of reaction increasing from 5°C to an optimum temperature, and then decreasing towards 45°C.
Answer: E
Question 77
1 markRed blood cells are produced by stem cells in the bone marrow.
A sample of blood from a healthy person was found to contain red blood cells.
The person has a consistent average total blood volume of . Their total red blood cell count does not change and, on average, red blood cells have a lifespan of 100 days.
Which of the following statements is/are correct?
1 Red blood cells are phagocytic cells.
2 The average rate of production of red blood cells is cells per hour.
3 The stem cells that produce red blood cells do not have nuclei.
A sample of blood from a healthy person was found to contain red blood cells.
The person has a consistent average total blood volume of . Their total red blood cell count does not change and, on average, red blood cells have a lifespan of 100 days.
Which of the following statements is/are correct?
1 Red blood cells are phagocytic cells.
2 The average rate of production of red blood cells is cells per hour.
3 The stem cells that produce red blood cells do not have nuclei.
- A.none of them
- B.1 only
- C.2 only
- D.3 only
- E.1 and 2 only
- F.1 and 3 only
- G.2 and 3 only
- H.1, 2 and 3
Answer: C